pProEX HTA plasmid - 2ug

https://www.gen.bg/web/image/product.template/1253/image_1920?unique=d873790

£ 268.60 268.6 GBP £ 268.60

316.00 €

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    pProEX HTA Plasmid

    PVT0373-1   2ug
     

    pProEX HTA Plasmid Infomation

    Plasmid type: expression of Escherichia coli

    Expression level: high

    Cloning methods: polyclonal sites, restrictive endonucleases

    Carrier size: 4751bp

    Sequence primer sequence of 5'sequencing: M13/pUC Reverse: AGCGGATAACAATTTCACACAGG (Invitrogen)

    Sequence primer sequence of 3'sequencing: pTrcHis Reverse: GATTTAATCTGTATCAGG (Invitrogen)

    Carrier label: N-His, N-TEV protease cutting site

    Carrier resistance: ampicin

    Remarks:

    Hosts: E.coli. Related vectors: pBR322.

    Product directory number: 50609

    Stability: instantaneous expression of Transient

    Composition / inducible type: inducible type

    Virus / non virus: non virus
     

    pProEX HTA Plasmid Description
    pProEX HT series prokaryotic expression system is a carrier used to express foreign proteins in Escherichia coli. The target protein expressed by this carrier contains 6 His purify labels. The target gene can be cloned into the polyclonal site of the vector. After the expression of pProEX HTa, B and C. protein is selected, the His purification tag is located at the N end of the target protein. Meanwhile, the use of His purification tag can be used for protein purification. The rTEV protease identification site is also contained on the carrier, and the rTEV protease can be used for enzyme digestion to remove the fused His label.

     

    pProEX HTA Plasmid Sequence

    LOCUS       pPROEX HTa    4751 bp     DNA    circular     SYN
    DEFINITION  pPROEX HTa
    ACCESSION   
    KEYWORDS    
    SOURCE      
      ORGANISM  other sequences; artificial sequences; vectors.
    FEATURES             Location/Qualifiers
         source          1..4751
                         /organism="pPROEX HTa"
                         /mol_type="other DNA"
         promoter        193..266
                         /label="trc_promoter"
         misc_feature    235..257
                         /label="M13_pUC_rev_primer"
         misc_feature    complement(472..489)
                         /label="pTrcHis_rev_primer"
         misc_feature    complement(472..489)
                         /label="pBAD_rev_primer"
         terminator      522..679
                         /label="rrnB_terminator"
         terminator      645..688
                         /label="rrnB_T1_terminator"
         terminator      820..847
                         /label="rrnB_T2_terminator"
         promoter        889..917
                         /label="AmpR_promoter"
         gene            959..1819
                         /label="Ampicillin"
                         /gene="Ampicillin"
         CDS             959..1819
                         /label="ORF frame 2"
         rep_origin      1974..2593
                         /label="pBR322_origin"
         rep_origin      complement(2931..3237)
                         /label="f1_origin"
         misc_feature    3452..3474
                         /label="pGEX_3_primer"
         misc_feature    3621..4712
                         /label="lacI"
         CDS             3753..4712
                         /label="ORF frame 3"
    ORIGIN
        1 GTTTGACAGC TTATCATCGA CTGCACGGTG CACCAATGCT TCTGGCGTCA GGCAGCCATC
       61 GGAAGCTGTG GTATGGCTGT GCAGGTCGTA AATCACTGCA TAATTCGTGT CGCTCAAGGC
      121 GCACTCCCGT TCTGGATAAT GTTTTTTGCG CCGACATCAT AACGGTTCTG GCAAATATTC
      181 TGAAATGAGC TGTTGACAAT TAATCATCCG GTCCGTATAA TCTGTGGAAT TGTGAGCGGA
      241 TAACAATTTC ACACAGGAAA CAGACCATGT CGTACTACCA TCACCATCAC CATCACGATT
      301 ACGATATCCC AACGACCGAA AACCTGTATT TTCAGGGCGC CATGGATCCG GAATTCAAAG
      361 GCCTACGTCG ACGAGCTCAA CTAGTGCGGC CGCTTTCGAA TCTAGAGCCT GCAGTCTCGA
      421 GGCATGCGGT ACCAAGCTTG GCTGTTTTGG CGGATGAGAG AAGATTTTCA GCCTGATACA
      481 GATTAAATCA GAACGCAGAA GCGGTCTGAT AAAACAGAAT TTGCCTGGCG GCAGTAGCGC
      541 GGTGGTCCCA CCTGACCCCA TGCCGAACTC AGAAGTGAAA CGCCGTAGCG CCGATGGTAG
      601 TGTGGGGTCT CCCCATGCGA GAGTAGGGAA CTGCCAGGCA TCAAATAAAA CGAAAGGCTC
      661 AGTCGAAAGA CTGGGCCTTT CGTTTTATCT GTTGTTTGTC GGTGAACGCT CTCCTGAGTA
      721 GGACAAATCC GCCGGGAGCG GATTTGAACG TTGCGAAGCA ACGGCCCGGA GGGTGGCGGG
      781 CAGGACGCCC GCCATAAACT GCCAGGCATC AAATTAAGCA GAAGGCCATC CTGACGGATG
      841 GCCTTTTTGC GTTTCTACAA ACTCTTTTTG TTTATTTTTC TAAATACATT CAAATATGTA
      901 TCCGCTCATG AGACAATAAC CCTGATAAAT GCTTCAATAA TATTGAAAAA GGAAGAGTAT
      961 GAGTATTCAA CATTTCCGTG TCGCCCTTAT TCCCTTTTTT GCGGCATTTT GCCTTCCTGT
     1021 TTTTGCTCAC CCAGAAACGC TGGTGAAAGT AAAAGATGCT GAAGATCAGT TGGGTGCACG
     1081 AGTGGGTTAC ATCGAACTGG ATCTCAACAG CGGTAAGATC CTTGAGAGTT TTCGCCCCGA
     1141 AGAACGTTTT CCAATGATGA GCACTTTTAA AGTTCTGCTA TGTGGCGCGG TATTATCCCG
     1201 TGTTGACGCC GGGCAAGAGC AACTCGGTCG CCGCATACAC TATTCTCAGA ATGACTTGGT
     1261 TGAGTACTCA CCAGTCACAG AAAAGCATCT TACGGATGGC ATGACAGTAA GAGAATTATG
     1321 CAGTGCTGCC ATAACCATGA GTGATAACAC TGCGGCCAAC TTACTTCTGA CAACGATCGG
     1381 AGGACCGAAG GAGCTAACCG CTTTTTTGCA CAACATGGGG GATCATGTAA CTCGCCTTGA
     1441 TCGTTGGGAA CCGGAGCTGA ATGAAGCCAT ACCAAACGAC GAGCGTGACA CCACGATGCC
     1501 TACAGCAATG GCAACAACGT TGCGCAAACT ATTAACTGGC GAACTACTTA CTCTAGCTTC
     1561 CCGGCAACAA TTAATAGACT GGATGGAGGC GGATAAAGTT GCAGGACCAC TTCTGCGCTC
     1621 GGCCCTTCCG GCTGGCTGGT TTATTGCTGA TAAATCTGGA GCCGGTGAGC GTGGGTCTCG
     1681 CGGTATCATT GCAGCACTGG GGCCAGATGG TAAGCCCTCC CGTATCGTAG TTATCTACAC
     1741 GACGGGGAGT CAGGCAACTA TGGATGAACG AAATAGACAG ATCGCTGAGA TAGGTGCCTC
     1801 ACTGATTAAG CATTGGTAAC TGTCAGACCA AGTTTACTCA TATATACTTT AGATTGATTT
     1861 AAAACTTCAT TTTTAATTTA AAAGGATCTA GGTGAAGATC CTTTTTGATA ATCTCATGAC
     1921 CAAAATCCCT TAACGTGAGT TTTCGTTCCA CTGAGCGTCA GACCCCGTAG AAAAGATCAA
     1981 AGGATCTTCT TGAGATCCTT TTTTTCTGCG CGTAATCTGC TGCTTGCAAA CAAAAAAACC
     2041 ACCGCTACCA GCGGTGGTTT GTTTGCCGGA TCAAGAGCTA CCAACTCTTT TTCCGAAGGT
     2101 AACTGGCTTC AGCAGAGCGC AGATACCAAA TACTGTCCTT CTAGTGTAGC CGTAGTTAGG
     2161 CCACCACTTC AAGAACTCTG TAGCACCGCC TACATACCTC GCTCTGCTAA TCCTGTTACC
     2221 AGTGGCTGCT GCCAGTGGCG ATAAGTCGTG TCTTACCGGG TTGGACTCAA GACGATAGTT
     2281 ACCGGATAAG GCGCAGCGGT CGGGCTGAAC GGGGGGTTCG TGCACACAGC CCAGCTTGGA
     2341 GCGAACGACC TACACCGAAC TGAGATACCT ACAGCGTGAG CTATGAGAAA GCGCCACGCT
     2401 TCCCGAAGGG AGAAAGGCGG ACAGGTATCC GGTAAGCGGC AGGGTCGGAA CAGGAGAGCG
     2461 CACGAGGGAG CTTCCAGGGG GAAACGCCTG GTATCTTTAT AGTCCTGTCG GGTTTCGCCA
     2521 CCTCTGACTT GAGCGTCGAT TTTTGTGATG CTCGTCAGGG GGGCGGAGCC TATGGAAAAA
     2581 CGCCAGCAAC GCGGCCTTTT TACGGTTCCT GGCCTTTTGC TGGCCTTTTG CTCACATGTT
     2641 CTTTCCTGCG TTATCCCCTG ATTCTGTGGA TAACCGTATT ACCGCCTTTG AGTGAGCTGA
     2701 TACCGCTCGC CGCAGCCGAA CGACCGAGCG CAGCGAGTCA GTGAGCGAGG AAGCGGAAGA
     2761 GCGCCTGATG CGGTATTTTC TCCTTACGCA TCTGTGCGGT ATTTCACACC GCATAATTTT
     2821 GTTAAAATTC GCGTTAAATT TTTGTTAAAT CAGCTCATTT TTTAACCAAT AGGCCGAAAT
     2881 CGGCAAAATC CCTTATAAAT CAAAAGAATA GACCGAGATA GGGTTGAGTG TTGTTCCAGT
     2941 TTGGAACAAG AGTCCACTAT TAAAGAACGT GGACTCCAAC GTCAAAGGGC GAAAAACCGT
     3001 CTATCAGGGC GATGGCCCAC TACGTGAACC ATCACCCTAA TCAAGTTTTT TGGGGTCGAG
     3061 GTGCCGTAAA GCACTAAATC GGAACCCTAA AGGGAGCCCC CGATTTAGAG CTTGACGGGG
     3121 AAAGCCGGCG AACGTGGCGA GAAAGGAAGG GAAGAAAGCG AAAGGAGCGG GCGCTAGGGC
     3181 GCTGGCAAGT GTAGCGGTCA CGCTGCGCGT AACCACCACA CCCGCCGCGC TTAATGCGCC
     3241 GCTACAGGGC GCGTCCCATT CGCCATTCAG GCTGCTATGG TGCACTCTCA GTACAATCTG
     3301 CTCTGATGCC GCATAGTTAA GCCAGTATAC ACTCCGCTAT CGCTACGTGA CTGGGTCATG
     3361 GCTGCGCCCC GACACCCGCC AACACCCGCT GACGCGCCCT GACGGGCTTG TCTGCTCCCG
     3421 GCATCCGCTT ACAGACAAGC TGTGACCGTC TCCGGGAGCT GCATGTGTCA GAGGTTTTCA
     3481 CCGTCATCAC CGAAACGCGC GAGGCAGCAG ATCAATTCGC GCGCGAAGGC GAAGCGGCAT
     3541 GCATTTACGT TGACACCATC GAATGGTGCA AAACCTTTCG CGGTATGGCA TGATAGCGCC
     3601 CGGAAGAGAG TCAATTCAGG GTGGTGAATG TGAAACCAGT AACGTTATAC GATGTCGCAG
     3661 AGTATGCCGG TGTCTCTTAT CAGACCGTTT CCCGCGTGGT GAACCAGGCC AGCCACGTTT
     3721 CTGCGAAAAC GCGGGAAAAA GTGGAAGCGG CGATGGCGGA GCTGAATTAC ATTCCCAACC
     3781 GCGTGGCACA ACAACTGGCG GGCAAACAGT CGTTGCTGAT TGGCGTTGCC ACCTCCAGTC
     3841 TGGCCCTGCA CGCGCCGTCG CAAATTGTCG CGGCGATTAA ATCTCGCGCC GATCAACTGG
     3901 GTGCCAGCGT GGTGGTGTCG ATGGTAGAAC GAAGCGGCGT CGAAGCCTGT AAAGCGGCGG
     3961 TGCACAATCT TCTCGCGCAA CGCGTCAGTG GGCTGATCAT TAACTATCCG CTGGATGACC
     4021 AGGATGCCAT TGCTGTGGAA GCTGCCTGCA CTAATGTTCC GGCGTTATTT CTTGATGTCT
     4081 CTGACCAGAC ACCCATCAAC AGTATTATTT TCTCCCATGA AGACGGTACG CGACTGGGCG
     4141 TGGAGCATCT GGTCGCATTG GGTCACCAGC AAATCGCGCT GTTAGCGGGC CCATTAAGTT
     4201 CTGTCTCGGC GCGTCTGCGT CTGGCTGGCT GGCATAAATA TCTCACTCGC AATCAAATTC
     4261 AGCCGATAGC GGAACGGGAA GGCGACTGGA GTGCCATGTC CGGTTTTCAA CAAACCATGC
     4321 AAATGCTGAA TGAGGGCATC GTTCCCACTG CGATGCTGGT TGCCAACGAT CAGATGGCGC
     4381 TGGGCGCAAT GCGCGCCATT ACCGAGTCCG GGCTGCGCGT TGGTGCGGAT ATCTCGGTAG
     4441 TGGGATACGA CGATACCGAA GACAGCTCAT GTTATATCCC GCCGTTAACC ACCATCAAAC
     4501 AGGATTTTCG CCTGCTGGGG CAAACCAGCG TGGACCGCTT GCTGCAACTC TCTCAGGGCC
     4561 AGGCGGTGAA GGGCAATCAG CTGTTGCCCG TCTCACTGGT GAAAAGAAAA ACCACCCTGG
     4621 CACCCAATAC GCAAACCGCC TCTCCCCGCG CGTTGGCCGA TTCATTAATG CAGCTGGCAC
     4681 GACAGGTTTC CCGACTGGAA AGCGGGCAGT GAGCGCAACG CAATTAATGT GAGTTAGCGC
     4741 GAATTGATCT G
    //

    Caution:
    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.Take 2ul plasmid into 100 μ L corresponding competent cell, centrifugal then full coating on plate.