pGreen II- 0800- Luc, 2ug
(0 review)

£ 405.45 405.45 GBP £ 405.45 VAT Excluded

477.00 € VAT Excluded

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    pGreen II-0800-Luc

    Catalog No. PVT11187
    Packing 2ug


    pGreenII 0800-Luc Information

    Promoter: CaMV 35S, T7

    Replicon: pSa ori, ori

    Plasmid classification: plant series, protein overexpression vector

    Plasmid size: 6382bp

    Prokaryotic resistance: Kan

    Clonal strain: DH5 alpha

    Culture conditions: 37 C, aerobic LB

    Expression host: plant cells

    5'sequencing primers: 35S:GACGCACAATCCCACTATCC

    Primers for 3'sequencing: primers designed based on sequences


    pGreenII 0800-Luc Description

    We describe novel plasmid vectors for transient gene expression usingAgrobacterium, infiltrated into Nicotiana benthamiana leaves. We have generated a series of pGreenIIcloning vectors that are ideally suited to transient gene expression, by removing elements of onventional binary vectors necessary for stable transformation such as transformation selection genes.


    pGreenII 0800-Luc Multiple cloning site



    pGreenII 0800-Luc Sequence

    LOCUS       Exported                6382 bp ds-DNA     circular SYN 14-SEP-2016

    DEFINITION  synthetic circular DNA


    VERSION     .

    KEYWORDS    Untitled 8

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 6382)

      AUTHORS   .

      TITLE     Direct Submission

      JOURNAL   Exported Wednesday, September 14, 2016 from SnapGene Viewer 3.2.1

    FEATURES             Location/Qualifiers

         source          1..6382

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         misc_feature    542..564

                         /note="LB T-DNA repeat"

                         /note="left border repeat from nopaline C58 T-DNA 


         promoter        626..971

                         /note="CaMV 35S promoter"

                         /note="strong constitutive promoter from cauliflower mosaic


         CDS             982..1917


                         /product="luciferase from the anthozoan coelenterate 

                         Renilla reniformis (sea pansy)"








         polyA_signal    1974..2150

                         /note="CaMV poly(A) signal"

                         /note="cauliflower mosaic virus polyadenylation signal"

         primer_bind     2314..2330

                         /note="M13 fwd"

                         /note="common sequencing primer, one of multiple similar 


         promoter        2337..2355

                         /note="T7 promoter"

                         /note="promoter for bacteriophage T7 RNA polymerase"

         primer_bind     2381..2397

                         /note="KS primer"

                         /note="common sequencing primer, one of multiple similar 


         primer_bind     complement(2431..2447)

                         /note="SK primer"

                         /note="common sequencing primer, one of multiple similar 


         CDS             2479..4131



                         /product="firefly luciferase"


                         /note="enhanced luc+ version of the luciferase gene"











         polyA_signal    4188..4364

                         /note="CaMV poly(A) signal"

                         /note="cauliflower mosaic virus polyadenylation signal"

         misc_feature    4374..4398

                         /note="RB T-DNA repeat"

                         /note="right border repeat from nopaline C58 T-DNA"

         rep_origin      complement(4489..5077)



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


         CDS             complement(5248..6063)



                         /product="aminoglycoside phosphotransferase"


                         /note="confers resistance to kanamycin in bacteria or G418 

                         (Geneticin(R)) in eukaryotes"






         rep_origin      6354..407

                         /note="pSa ori"

                         /note="origin of replication from bacterial plasmid pSa"


            1 tttttatccc cggaagcctg tggatagagg gtagttatcc acgtgaaacc gctaatgccc

           61 cgcaaagcct tgattcacgg ggctttccgg cccgctccaa aaactatcca cgtgaaatcg

          121 ctaatcaggg tacgtgaaat cgctaatcgg agtacgtgaa atcgctaata aggtcacgtg

          181 aaatcgctaa tcaaaaaggc acgtgagaac gctaatagcc ctttcagatc aacagcttgc

          241 aaacacccct cgctccggca agtagttaca gcaagtagta tgttcaatta gcttttcaat

          301 tatgaatata tatatcaatt attggtcgcc cttggcttgt ggacaatgcg ctacgcgcac

          361 cggctccgcc cgtggacaac cgcaagcggt tgcccaccgt cgagcgccag cgcctttgcc

          421 cacaacccgg cggccggccg caacagatcg ttttataaat tttttttttt gaaaaagaaa

          481 aagcccgaaa ggcggcaacc tctcgggctt ctggatttcc gatccccgga attagagatc

          541 ttggcaggat atattgtggt gtaacgttat cgtaccccta ctccaaaaat gtcaaagata

          601 cagtctcaga agaccaaagg gctattgaga cttttcaaca aagggtaatt tcgggaaacc

          661 tcctcggatt ccattgccca gctatctgtc acttcatcga aaggacagta gaaaaggaag

          721 gtggctccta caaatgccat cattgcgata aaggaaaggc tatcattcaa gatgcctctg

          781 ccgacagtgg tcccaaagat ggacccccac ccacgaggag catcgtggaa aaagaagacg

          841 ttccaaccac gtcttcaaag caagtggatt gatgtgacat ctccactgac gtaagggatg

          901 acgcacaatc ccactatcct tcgcaagacc cttcctctat ataaggaagt tcatttcatt

          961 tggagaggac agcccaccac catgacttcg aaagtttatg atccagaaca aaggaaacgg

         1021 atgataactg gtccgcagtg gtgggccaga tgtaaacaaa tgaatgttct tgattcattt

         1081 attaattatt atgattcaga aaaacatgca gaaaatgctg ttattttttt acatggtaac

         1141 gcggcctctt cttatttatg gcgacatgtt gtgccacata ttgagccagt agcgcggtgt

         1201 attataccag accttattgg tatgggcaaa tcaggcaaat ctggtaatgg ttcttatagg

         1261 ttacttgatc attacaaata tcttactgca tggtttgaac ttcttaattt accaaagaag

         1321 atcatttttg tcggccatga ttggggtgct tgtttggcat ttcattatag ctatgagcat

         1381 caagataaga tcaaagcaat agttcacgct gaaagtgtag tagatgtgat tgaatcatgg

         1441 gatgaatggc ctgatattga agaagatatt gcgttgatca aatctgaaga aggagaaaaa

         1501 atggttttgg agaataactt cttcgtggaa accatgttgc catcaaaaat catgagaaag

         1561 ttagaaccag aagaatttgc agcatatctt gaaccattca aagagaaagg tgaagttcgt

         1621 cgtccaacat tatcatggcc tcgtgaaatc ccgttagtaa aaggtggtaa acctgacgtt

         1681 gtacaaattg ttaggaatta taatgcttat ctacgtgcaa gtgatgattt accaaaaatg

         1741 tttattgaat cggacccagg attcttttcc aatgctattg ttgaaggtgc caagaagttt

         1801 cctaatactg aatttgtcaa agtaaaaggt cttcattttt cgcaagaaga tgcacctgat

         1861 gaaatgggaa aatatatcaa atcgttcgtt gagcgagttc tcaaaaatga acaataattc

         1921 tagccggtac gctgaaatca ccagtctctc tctacaaatc tatctctctc tattttctcc

         1981 ataaataatg tgtgagtagt ttcccgataa gggaaattag ggttcttata gggtttcgct

         2041 catgtgttga gcatataaga aacccttagt atgtatttgt atttgtaaaa tacttctatc

         2101 aataaaattt ctaattccta aaaccaaaat ccagtactaa aatccagatc gataacatta

         2161 acgtttacaa tttccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc

         2221 gggcctcttc gctattacgc cagctggcga aagggggatg tgctgcaagg cgattaagtt

         2281 gggtaacgcc agggttttcc cagtcacgac gttgtaaaac gacggccagt gaattgtaat

         2341 acgactcact atagggcgaa ttgggtaccg ggccccccct cgaggtcgac ggtatcgata

         2401 agcttgatat cgaattcctg cagcccgggg gatccactag ttctagagcg gccgccaccg

         2461 cggtggagat cgaattccat ggaagacgcc aaaaacataa agaaaggccc ggcgccattc

         2521 tatccgctgg aagatggaac cgctggagag caactgcata aggctatgaa gagatacgcc

         2581 ctggttcctg gaacaattgc ttttacagat gcacatatcg aggtggacat cacttacgct

         2641 gagtacttcg aaatgtccgt tcggttggca gaagctatga aacgatatgg gctgaataca

         2701 aatcacagaa tcgtcgtatg cagtgaaaac tctcttcaat tctttatgcc ggtgttgggc

         2761 gcgttattta tcggagttgc agttgcgccc gcgaacgaca tttataatga acgtgaattg

         2821 ctcaacagta tgggcatttc gcagcctacc gtggtgttcg tttccaaaaa ggggttgcaa

         2881 aaaattttga acgtgcaaaa aaagctccca atcatccaaa aaattattat catggattct

         2941 aaaacggatt accagggatt tcagtcgatg tacacgttcg tcacatctca tctacctccc

         3001 ggttttaatg aatacgattt tgtgccagag tccttcgata gggacaagac aattgcactg

         3061 atcatgaact cctctggatc tactggtctg cctaaaggtg tcgctctgcc tcatagaact

         3121 gcctgcgtga gattctcgca tgccagagat cctatttttg gcaatcaaat cattccggat

         3181 actgcgattt taagtgttgt tccattccat cacggttttg gaatgtttac tacactcgga

         3241 tatttgatat gtggatttcg agtcgtctta atgtatagat ttgaagaaga gctgtttctg

         3301 aggagccttc aggattacaa gattcaaagt gcgctgctgg tgccaaccct attctccttc

         3361 ttcgccaaaa gcactctgat tgacaaatac gatttatcta atttacacga aattgcttct

         3421 ggtggcgctc ccctctctaa ggaagtcggg gaagcggttg ccaagaggtt ccatctgcca

         3481 ggtatcaggc aaggatatgg gctcactgag actacatcag ctattctgat tacacccgag

         3541 ggggatgata aaccgggcgc ggtcggtaaa gttgttccat tttttgaagc gaaggttgtg

         3601 gatctggata ccgggaaaac gctgggcgtt aatcaaagag gcgaactgtg tgtgagaggt

         3661 cctatgatta tgtccggtta tgtaaacaat ccggaagcga ccaacgcctt gattgacaag

         3721 gatggatggc tacattctgg agacatagct tactgggacg aagacgaaca cttcttcatc

         3781 gttgaccgcc tgaagtctct gattaagtac aaaggctatc aggtggctcc cgctgaattg

         3841 gaatccatct tgctccaaca ccccaacatc ttcgacgcag gtgtcgcagg tcttcccgac

         3901 gatgacgccg gtgaacttcc cgccgccgtt gttgttttgg agcacggaaa gacgatgacg

         3961 gaaaaagaga tcgtggatta cgtcgccagt caagtaacaa ccgcgaaaaa gttgcgcgga

         4021 ggagttgtgt ttgtggacga agtaccgaaa ggtcttaccg gaaaactcga cgcaagaaaa

         4081 atcagagaga tcctcataaa ggccaagaag ggcggaaaga tcgccgtgta attctagaga

         4141 attcgctgaa atcaccagtc tctctctaca aatctatctc tctctatttt ctccataaat

         4201 aatgtgtgag tagtttcccg ataagggaaa ttagggttct tatagggttt cgctcatgtg

         4261 ttgagcatat aagaaaccct tagtatgtat ttgtatttgt aaaatacttc tatcaataaa

         4321 atttctaatt cctaaaacca aaatccagta ctaaaatcca gatccactag ccttgacagg

         4381 atatattggc gggtaaacta agtcgctgta tgtgtttgtt tgagatctca tgtgagcaaa

         4441 aggccagcaa aaggccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct

         4501 ccgcccccct gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac

         4561 aggactataa agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc

         4621 gaccctgccg cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc

         4681 tcatagctca cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg

         4741 tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga

         4801 gtccaacccg gtaagacacg acttatcgcc actggcagca gccactggta acaggattag

         4861 cagagcgagg tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta

         4921 cactagaaga acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaagaag

         4981 agttggtagc tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg

         5041 caagcagcag attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac

         5101 ggggtctgac gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc

         5161 aaaaaggatc ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag

         5221 tatatatgtg taacattggt ctagtgatta gaaaaactca tcgagcatca aatgaaactg

         5281 caatttattc atatcaggat tatcaatacc atatttttga aaaagccgtt tctgtaatga

         5341 aggagaaaac tcaccgaggc agttccatag gatggcaaga tcctggtatc ggtctgcgat

         5401 tccgactcgt ccaacatcaa tacaacctat taatttcccc tcgtcaaaaa taaggttatc

         5461 aagtgagaaa tcaccatgag tgacgactga atccggtgag aatggcaaaa gtttatgcat

         5521 ttctttccag acttgttcaa caggccagcc attacgctcg tcatcaaaat cactcgcatc

         5581 aaccaaaccg ttattcattc gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt

         5641 aaaaggacaa ttacaaacag gaatcgaatg caaccggcgc aggaacactg ccagcgcatc

         5701 aacaatattt tcacctgaat caggatattc ttctaatacc tggaatgctg ttttccctgg

         5761 gatcgcagtg gtgagtaacc atgcatcatc aggagtacgg ataaaatgct tgatggtcgg

         5821 aagaggcata aattccgtca gccagtttag tctgaccatc tcatctgtaa caacattggc

         5881 aacgctacct ttgccatgtt tcagaaacaa ctctggcgca tcgggcttcc catacaatcg

         5941 gtagattgtc gcacctgatt gcccgacatt atcgcgagcc catttatacc catataaatc

         6001 agcatccatg ttggaattta atcgcggcct tgagcaagac gtttcccgtt gaatatggct

         6061 cataacaccc cttgtattac tgtttatgta agcagacagt tttattgttc atgatgatat

         6121 atttttatct tgtgcaatgt aacatcagag attttgagac acaacgtggc tttgttgaat

         6181 aaatcgaact tttgctgagt tgaaggatca gatcacgcat cttcccgaca acgcagaccg

         6241 ttccgtggca aagcaaaagt tcaaaatcac caactggtcc acctacaaca aagctctcat

         6301 caaccgtggc tccctcactt tctggctgga tgatggggcg attcaggcga tccccatcca

         6361 acagcccgcc gtcgagcggg ct



    Product is for research use only!