pPR3- N plasmid - 2ug

(0 review)

£ 255.85 255.85 GBP £ 255.85 VAT Excluded

301.00 € VAT Excluded

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days


    Catalog No. PVT11260
    Packing 2ug


    pPR3-N Information
    Function yeast Hybrid plasmid

    Promoter: CYC1 promoter

    Replicator: pUC ori, F1 ori, 2 mu ori

    Terminator: CYC1 Terminator

    Plasmid classification: yeast cell plasmids, yeast hybrid plasmids, two hybrid plasmids.

    Plasmid size: 6200bp

    Plasmid label: N-NubG; N-HA

    Prokaryotic resistance: ampicillin Amp

    Screening markers: TRP1

    Cloned strains of Escherichia coli, DH5 A and other Escherichia coli

    Culture conditions: 37 centigrade, LB, aerobic

    Expression host: yeast

    Culture conditions: 30 centigrade, YPD, aerobic

    5'sequencing primers: CYC1-F:CTTTCCTTATACATTAGGACC

    3'sequencing primers: CYC1-R:GGGACCTAGACTTCAGGTTG

    Note: high copy plasmids


    pPR3-N Description

    PPR3-N is a plasmid for yeast two hybrid experiment of membrane proteins.The DUALmembrane system is intended for the detection and identification of interactions involving integral membrane proteins and membrane-associated proteins in yeast. The DUALmembrane pairwise interaction kit enables you to: Investigate the interaction between a membrane protein (integral or membrane-associated) and a membrane protein or soluble protein Map domains or amino acids which are critical for an interaction Screen cDNA libraries using a membrane protein as a bait to find novel interacting proteins (requires purchase of a separate cDNA library from Dualsystems)


    pPR3-N Sequence

    LOCUS       Exported                6200 bp ds-DNA     circular SYN 17-SEP-2017

    DEFINITION  synthetic circular DNA

    KEYWORDS    pPR3-N

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 6200)

      AUTHORS   yin

      TITLE     Direct Submission

      JOURNAL   Exported Sep 17, 2017

    FEATURES             Location/Qualifiers

         source          1..6200

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         misc_feature    64..360

                         /label=CYC1 promoter

         misc_feature    367..369


         CDS             487..513


                         /product="HA (human influenza hemagglutinin) epitope tag"



         misc_feature    514..623


         terminator      630..881

                         /gene="S. cerevisiae CYC1"

                         /label=CYC1 terminator

                         /note="transcription terminator for CYC1"

         rep_origin      1081..1536


                         /label=f1 ori

                         /note="f1 bacteriophage origin of replication; arrow 

                         indicates direction of (+) strand synthesis"

         CDS             complement(1634..2308)


                         /gene="S. cerevisiae TRP1"

                         /product="phosphoribosylanthranilate isomerase, required 

                         for tryptophan biosynthesis"


                         /note="yeast auxotrophic marker"






         promoter        complement(2309..2589)

                         /gene="S. cerevisiae TRP1"

                         /label=TRP1 promoter

         rep_origin      2844..4186

                         /label=2u ori

                         /note="yeast 2u plasmid origin of replication"

         promoter        4213..4317


                         /label=AmpR promoter

         CDS             4318..5178





                         /note="confers resistance to ampicillin, carbenicillin, and

                         related antibiotics"







         rep_origin      5349..5937



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


    ORIGIN(For reference)

            1 gccgcggatg attacgccaa gcgcgcaatt aaccctcact aaagggaaca aaagctggag

           61 ctctcatttg gcgagcgttg gttggtggat caagcccacg cgtaggcaat cctcgagcag

          121 atccgccagg cgtgtatata tagcgtggat ggccaggcaa ctttagtgct gacacataca

          181 ggcatatata tatgtgtgcg acgacacatg atcatatggc atgcatgtgc tctgtatgta

          241 tataaaactc ttgttttctt cttttctcta aatattcttt ccttatacat taggaccttt

          301 gcagcataaa ttactatact tctatagaca cgcaaacaca aatacacaca ctaatctaga

          361 actagtatgc agattttcgt caagactttg accggtaaaa ccggaacatt ggaagttgaa

          421 tcttccgata ccatcgacaa cgttaagtcg aaaattcaag acaaggaagg aatccctggt

          481 ggtccatacc catacgatgt tccagattac gctggatcca agcagtggta tcaacgcaga

          541 gtggccatta cggcccggga aaaaacatgt cggccgcctc ggcctctcga gaattcgata

          601 tcaagcttat cgataccgtc gacctcgagt catgtaatta gttatgtcac gcttacattc

          661 acgccctccc cccacatccg ctctaaccga aaaggaagga gttagacaac ctgaagtcta

          721 ggtccctatt tattttttta tagttatgtt agtattaaga acgttattta tatttcaaat

          781 ttttcttttt tttctgtaca gacgcgtgta cgcatgtaac attatactga aaaccttgct

          841 tgagaaggtt ttgggacgct cgaaggcttt aatttgcggc cggtacccaa ttcgccctat

          901 agtgagtcgt attacgcgcg ctcactggcc gtcgttttac aacgtcgtga ctgggaaaac

          961 cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag ctggcgtaat

         1021 agcgaagagg cccgcaccga tcgcccttcc caacagttgc gcagcctgaa tggcgaatgg

         1081 acgcgccctg tagcggcgca ttaagcgcgg cgggtgtggt ggttacgcgc agcgtgaccg

         1141 ctacacttgc cagcgcccta gcgcccgctc ctttcgcttt cttcccttcc tttctcgcca

         1201 cgttcgccgg ctttccccgt caagctctaa atcgggggct ccctttaggg ttccgattta

         1261 gtgctttacg gcacctcgac cccaaaaaac ttgattaggg tgatggttca cgtagtgggc

         1321 catcgccctg atagacggtt tttcgccctt tgacgttgga gtccacgttc tttaatagtg

         1381 gactcttgtt ccaaactgga acaacactca accctatctc ggtctattct tttgatttat

         1441 aagggatttt gccgatttcg gcctattggt taaaaaatga gctgatttaa caaaaattta

         1501 acgcgaattt taacaaaata ttaacgttta caatttcctg atgcgtattt tctccttacg

         1561 catctgtgcg gtatttcaca ccgcataggc aagtgcacaa acaatactta aataaatact

         1621 actcagtaat aacctatttc ttagcatttt tgacgaaatt tgctattttg ttagagtctt

         1681 ttacaccatt tgtctccaca cctccgctta catcaacacc aataacgcca tttaatctaa

         1741 gcgcatcacc aacattttct ggcgtcagtc caccagctaa cataaaatgt aagctttcgg

         1801 ggctctcttg ccttccaacc cagtcagaaa tcgagttcca atccaaaagt tcacctgtcc

         1861 cacctgcttc tgaatcaaac aagggaataa acgaatgagg tttctgtgaa gctgcactga

         1921 gtagtatgtt gcagtctttt ggaaatacga gtcttttaat aactggcaaa ccgaggaact

         1981 cttggtattc ttgccacgac tcatctccat gcagttggac gatatcaatg ccgtaatcat

         2041 tgaccagagc caaaacatcc tccttaggtt gattacgaaa cacgccaacc aagtatttcg

         2101 gagtgcctga actattttta tatgctttta caagacttga aattttcctt gcaataaccg

         2161 ggtcaattgt tctctttcta ttgggcacac atataatacc cagcaagtca gcatcggaat

         2221 ctagagcaca ttctgcggcc tctgtgctct gcaagccgca aactttcacc aatggaccag

         2281 aactacctgt gaaattaata acagacatac tccaagctgc ctttgtgtgc ttaatcacgt

         2341 atactcacgt gctcaatagt caccaatgcc ctccctcttg gccctctcct tttctttttt

         2401 cgaccgaatt aattcttaat cggcaaaaaa agaaaagctc cggatcaaga ttgtacgtaa

         2461 ggtgacaagc tatttttcaa taaagaatat cttccactac tgccatctgg cgtcataact

         2521 gcaaagtaca catatattac gatgctgtct attaaatgct tcctatatta tatatatagt

         2581 aatgtcgttt atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc

         2641 cccgacaccc gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg

         2701 cttacagaca agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat

         2761 caccgaaacg cgcgagacga aagggcctcg tgatacgcct atttttatag gttaatgtca

         2821 tgataataat ggtttcttaa tatgatccaa tatcaaagga aatgatagca ttgaaggatg

         2881 agactaatcc aattgaggag tggcagcata tagaacagct aaagggtagt gctgaaggaa

         2941 gcatacgata ccccgcatgg aatgggataa tatcacagga ggtactagac tacctttcat

         3001 cctacataaa tagacgcata taagtacgca tttaagcata aacacgcact atgccgttct

         3061 tctcatgtat atatatatac aggcaacacg cagatatagg tgcgacgtga acagtgagct

         3121 gtatgtgcgc agctcgcgtt gcattttcgg aagcgctcgt tttcggaaac gctttgaagt

         3181 tcctattccg aagttcctat tctctagaaa gtataggaac ttcagagcgc ttttgaaaac

         3241 caaaagcgct ctgaagacgc actttcaaaa aaccaaaaac gcaccggact gtaacgagct

         3301 actaaaatat tgcgaatacc gcttccacaa acattgctca aaagtatctc tttgctatat

         3361 atctctgtgc tatatcccta tataacctac ccatccacct ttcgctcctt gaacttgcat

         3421 ctaaactcga cctctacatt ttttatgttt atctctagta ttactcttta gacaaaaaaa

         3481 ttgtagtaag aactattcat agagtgaatc gaaaacaata cgaaaatgta aacatttcct

         3541 atacgtagta tatagagaca aaatagaaga aaccgttcat aattttctga ccaatgaaga

         3601 atcatcaacg ctatcacttt ctgttcacaa agtatgcgca atccacatcg gtatagaata

         3661 taatcgggga tgcctttatc ttgaaaaaat gcacccgcag cttcgctagt aatcagtaaa

         3721 cgcgggaagt ggagtcaggc tttttttatg gaagagaaaa tagacaccaa agtagccttc

         3781 ttctaacctt aacggaccta cagtgcaaaa agttatcaag agactgcatt atagagcgca

         3841 caaaggagaa aaaaagtaat ctaagatgct ttgttagaaa aatagcgctc tcgggatgca

         3901 tttttgtaga acaaaaaaga agtatagatt ctttgttggt aaaatagcgc tctcgcgttg

         3961 catttctgtt ctgtaaaaat gcagctcaga ttctttgttt gaaaaattag cgctctcgcg

         4021 ttgcattttt gttttacaaa aatgaagcac agattcttcg ttggtaaaat agcgctttcg

         4081 cgttgcattt ctgttctgta aaaatgcagc tcagattctt tgtttgaaaa attagcgctc

         4141 tcgcgttgca tttttgttct acaaaatgaa gcacagatgc ttcgttcagg tggcactttt

         4201 cggggaaatg tgcgcggaac ccctatttgt ttatttttct aaatacattc aaatatgtat

         4261 ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag gaagagtatg

         4321 agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg ccttcctgtt

         4381 tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt gggtgcacga

         4441 gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt tcgccccgaa

         4501 gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt attatcccgt

         4561 attgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa tgacttggtt

         4621 gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag agaattatgc

         4681 agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac aacgatcgga

         4741 ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac tcgccttgat

         4801 cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac cacgatgcct

         4861 gtagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac tctagcttcc

         4921 cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact tctgcgctcg

         4981 gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg tgggtctcgc

         5041 ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt tatctacacg

         5101 acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat aggtgcctca

         5161 ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta gattgattta

         5221 aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa tctcatgacc

         5281 aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga aaagatcaaa

         5341 ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac aaaaaaacca

         5401 ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt tccgaaggta

         5461 actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc gtagttaggc

         5521 caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat cctgttacca

         5581 gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag acgatagtta

         5641 ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc cagcttggag

         5701 cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag cgccacgctt

         5761 cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac aggagagcgc

         5821 acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg gtttcgccac

         5881 ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct atggaaaaac

         5941 gccagcaacg cggcttttta cggttcctgg ccttttgctg gccttttgct cacatgttct

         6001 ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata

         6061 ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc

         6121 gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg

         6181 acaggtttcc cgactggaaa



    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.