pDSK-GFPuv plasmid - 2 ug

https://www.gentaur.be/web/image/product.template/8211/image_1920?unique=add1557

£ 392.70 392.7 GBP £ 392.70

462.00 €

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days

    Promoter: psbA


    Replicator: RSF1010


    Receptive state: DH5a


    Culture temperature: 37 degrees


    Plasmid host: Wide host


    Plasmid uses: Protein expression


    Segment type: ORF


    Prokaryotic resistance: Kan


    Fluorescent marking: green


    pDSK-GFPuv Sequence:

    TATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCCCGT

    TGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATC

    TTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATC

    AGATCACGCATCTTCCCGACAACGCAGACCGTTCCGTGGCAAAGCAAAAGTTCAAAATCACCAACTGGTCCACCTACAAC

    AAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGGGGCGATTCAGGCCTGGTATGAGTCAGCAACACC

    TTCTTCACGAGGCAGACCTCAGCGCTATTCTGACCTTGCCATCACGACTGTGCTGGTCATTAAACGCGTATTCAGGCTGA

    CCCTGCGCGCTGCGCAGGGCTTTATTGATTCCATTTTTACACTGATGAATGTTCCGTTGCGCTGCCCGGATTACAGCTGC

    GTTTCCTGTTTGGGGTCGTTTGCGGGAAGGGGCGGAATCCTACGCTAAGGCTTTGGCCAGCGATATTCTCCGGTGAGATT

    GATGTGTTCCCAGGGGATAGGAGAAGTCGCTTGATATCTAGTATGACGTCTGTCGCACCTGCTTGATCGCGGCCGCGATA

    GCTAGATCGCGTTGCTCCTCTTCTCCATCCGCGTTCCAAGCTGCGGAAAGGCACCCATAAGCGTACGCCTGGTCGAGCAG

    GCGACGCGGATCGACGTCCAGCGCACGAGAGAATGCGTCCGCCATCTGTGCAATGCGTCTAGGATCGAGACAAAGGTCGT

    CTCTGTCAGCCGGATCGTAGAACATATTGGCGGCGCCAAAGCCCACTTCACCGACCAGACATTCGCCATTCAGGCTGCGC

    AACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATT

    AAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTGAATTCGAGCTCGGTACCCGGGGAT

    CTAGAGGATCTCAATGAATATTGGTTGACACGGGCGTATAAGACATGTTATACTGTTGAATAACAAGCTTTCAATTCTCT

    ATTTTGAGAAGAATTAATGTGCTTGGGAGTCCCTGATGATTAAATTAAATAAACCAAGATTTTACCATGACTGCAATTTT

    AGAGAGACGGGGGATCGATCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGAGTAAAGGAGAAGA

    ACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGG

    GTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACA

    CTTGTCACTACTTTCTCTTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCATATGAAACGGCATGACTTTTTCAAGAG

    TGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGAACTACAAGACGCGTGCTGAAGTCA

    AGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACAC

    AAACTCGAGTACAACTATAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTAACTTCAA

    AATTCGCCACAACATTGAAGATGGATCAGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTG

    TCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTC

    CTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAATAAGGATCCTCTAGAGTCGACCT

    GCAGGCATGCAAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAAC

    ATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACT

    GCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTA

    TTGGGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGG

    AGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGA

    TGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTT

    TGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTC

    GCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAAGAAGAGCATACATCTGGAAGCAAAGCCAG

    GAAAGCGGCCTATGGAGCTGTGCGGCAGCGCTCAGTAGGCAATTTTTCAAAATATTGTTAAGCCTTTTCTGAGCATGGTA

    TTTTTCATGGTATTACCAATTAGCAGGAAAATAAGCCATTGAATATAAAAGATAAAAATGTCTTGTTTACAATAGAGTGG

    GGGGGGTCAGCCTGCCGCCTTGGGCCGGGTGATGTCGTACTTGCCCGCCGCGAACTCGGTTACCGTCCAGCCCAGCGCGA

    CCAGCTCCGGCAACGCCTCGCGCACCCGCTGGCGGCGCTTGCGCATGGTCGAACCACTGGCCTCTGACGGCCAGACATAG

    CCGCACAAGGTATCTATGGAAGCCTTGCCGGTTTTGCCGGGGTCGATCCAGCCACACAGCCGCTGGTGCAGCAGGCGGGC

    GGTTTCGCTGTCCAGCGCCCGCACCTCGTCCATGCTGATGCGCACATGCTGGCCGCCACCCATGACGGCCTGCGCGATCA

    AGGGGTTCAGGGCCACGTACAGGCGCCCGTCCGCCTCGTCGCTGGCGTACTCCGACAGCAGCCGAAACCCCTGCCGCTTG

    CGGCCATTCTGGGCGATGATGGATACCTTCCAAAGGCGCTCGATGCAGTCCTGTATGTGCTTGAGCGCCCCACCACTATC

    GACCTCTGCCCCGATTTCCTTTGCCAGCGCCCGATAGCTACCTTTGACCACCATGGCATCAGCGGTGACGGCCTCCCACT

    TGGGTTCCAGGAACAGCCGGAGCTGCCGTCCGCCTTCGGTCTTGGGTTCCGGGCCAAGCACTAGGCCATTAGGCCCAGCC

    ATGGCCACCAGCCCTTGCAGGATGCGCAGATCATCAGCGCCCAGCGGCTCCGGGCCGCTGAACTCGATCCGCTTGCCGTC

    GCCGTAGTCATACGTCACGTCCAGCTTGCTGCGCTTGCGCTCGCCCCGCTTGAGGGCACGGAACAGGCCGGGGGCCAGAC

    AGTGCGCCGGGTCGTGCCGGACGTGGCTGAGGCTGTGCTTGTTCTTAGGCTTCACCACGGGGCACCCCCTTGCTCTTGCG

    CTGCCTCTCCAGCACGGCGGGCTTGAGCACCCCGCCGTCATGCCGCCTGAACCACCGATCAGCGAACGGTGCGCCATAGT

    TGGCCTTGCTCACACCGAAGCGGACGAAGAACCGGCGCTGGTCGTCGTCCACACCCCATTCCTCGGCCTCGGCGCTGGTC

    ATGCTCGACAGGTAGGACTGCCAGCGGATGTTATCGACCAGTACCGAGCTGCCCCGGCTGGCCTGCTGCTGGTCGCCTGC

    GCCCATCATGGCCGCGCCCTTGCTGGCATGGTGCAGGAACACGATAGAGCACCCGGTATCGGCGGCGATGGCCTCCATGC

    GACCGATGACCTGGGCCATGGGGCCGCTGGCGTTTTCTTCCTCGATGTGGAACCGGCGCAGCGTGTCCAGCACCATCAGG

    CGGCGGCCCTCGGCGGCGCGCTTGAGGCCGTCGAACCACTCCGGGGCCATGATGTTGGGCAGGCTGCCGATCAGCGGCTG

    GATCAGCAGGCCGTCAGCCACGGCTTGCCGTTCCTCGGCGCTGAGGTGCGCCCCAAGGGCGTGCAGGCGGTGATGAATGG

    CGGTGGGCGGGTCTTCGGCGGGCAGGTAGATCACCGGGCCGGTGGGCAGTTCGCCCACCTCCAGCAGATCCGGCCCGCCT

    GCAATCTGTGCGGCCAGTTGCAGGGCCAGCATGGATTTACCGGCACCACCGGGCGACACCAGCGCCCCGACCGTACCGGC

    CACCATGTTGGGCAAAACGTAGTCCAGCGGTGGCGGCGCTGCTGCGAACGCCTCCAGAATATTGATAGGCTTATGGGTAG

    CCATTGATTGCCTCCTTTGCAGGCAGTTGGTGGTTAGGCGCTGGCGGGGTCACTACCCCCGCCCTGCGCCGCTCTGAGTT

    CTTCCAGGCACTCGCGCAGCGCCTCGTATTCGTCGTCGGTCAGCCAGAACTTGCGCTGACGCATCCCTTTGGCCTTCATG

    CGCTCGGCATATCGCGCTTGGCGTACAGCGTCAGGGCTGGCCAGCAGGTCGCCGGTCTGCTTGTCCTTTTGGTCTTTCAT

    ATCAGTCACCGAGAAACTTGCCGGGGCCGAAAGGCTTGTCTTCGCGGAACAAGGACAAGGTGCAGCCGTCAAGGTTAAGG

    CTGGCCATATCAGCGACTGAAAAGCGGCCAGCCTCGGCCTTGTTTGACGTATAACCAAAGCCACCGGGCAACCAATAGCC

    CTTGTCACTTTTGATCAGGTAGACCGACCCTGAAGCGCTTTTTTCGTATTCCATAAAACCCCCTTCTGTGCGTGAGTACT

    CATAGTATAACAGGCGTGAGTACCAACGCAAGCACTACATGCTGAAATCTGGCCCGCCCCTGTCCATGCCTCGCTGGCGG

    GGTGCCGGTGCCCGTGCCAGCTCGGCCCGCGCAAGCTGGACGCTGGGCAGACCCATGACCTTGCTGACGGTGCGCTCGAT

    GTAATCCGCTTCGTGGCCGGGCTTGCGCTCTGCCAGCGCTGGGCTGGCCTCGGCCATGGCCTTGCCGATTTCCTCGGCAC

    TGCGGCCCCGGCTGGCCAGCTTCTGCGCGGCGATAAAGTCGCACTTGCTGAGGTCATCACCGAAGCGCTTGACCAGCCCG

    GCCATCTCGCTGCGGTACTCGTCCAGCGCCGTGCGCCGGTGGCGGCTAAGCTGCCGCTCGGGCAGTTCGAGGCTGGCCAG

    CCTGCGGGCCTTCTCCTGCTGCCGCTGGGCCTGCTCGATCTGCTGGCCAGCCTGCTGCACCAGCGCCGGGCCAGCGGTGG

    CGGTCTTGCCCTTGGATTCACGCAGCAGCACCCACGGCTGATAACCGGCGCGGGTGGTGTGCTTGTCCTTGCGGTTGGTG

    AAGCCCGCCAAGCGGCCATAGTGGCGGCTGTCGGCGCTGGCCGGGTCGGCGTCGTACTCGCTGGCCAGCGTCCGGGCAAT

    CTGCCCCCGAAGTTCACCGCCTGCGGCGTCGGCCACCTTGACCCATGCCTGATAGTTCTTCGGGCTGGTTTCCACTACCA

    GGGCAGGCTCCCGGCCCTCGGCTTTCATGTCATCCAGGTCAAACTCGCTGAGGTCGTCCACCAGCACCAGACCATGCCGC

    TCCTGCTCGGCGGGCCTGATATACACGTCATTGCCCTGGGCATTCATCCGCTTGAGCCATGGCGTGTTCTGGAGCACTTC

    GGCGGCTGACCATTCCCGGTTCATCATCTGGCCGGTGGTGGCGTCCCTGACGCCGATATCGAAGCGCTCACAGCCCATGG

    CCTTGAGCTGTCGGCCTATGGCCTGCAAAGTCCTGTCGTTCTTCATCGGGCCACCAAGCGCAGCCAGATCGAGCCGTCCT

    CGGTTGTCAGTGGCGTCAGGTCGAGCAAGAGCAACGATGCGATCAGCAGCACCACCGTAGGCATCATGGAAGCCAGCATC

    ACGGTTAGCCATAGCTTCCAGTGCCACCCCCGCGACGCGCTCCGGGCGCTCTGCGCGGCGCTGCTCACCTCGGCGGCTAC......



    Caution:

    1.  This product is FOR RESEARCH USE ONLY!

    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.