PVT4003 - pPIC9K Plasmid 2ug

(0 review)

£ 306.00 306.0 GBP £ 306.00 VAT Excluded

360.00 € VAT Excluded

Not Available For Sale

    This combination does not exist.

    Terms and Conditions
    30-day money-back guarantee
    Shipping: 2-3 Business Days


    PVT4003      2ug


    pPIC9k Infomation

    Promoter: AOX1
    Replicon: pBR322 ori
    Plasmid classification: yeast series, Pichia pastoris expression vector
    Plasmid size: 9276bp
    Prokaryotic resistance: Amp, Kan
    Screening markers: HIS4
    Cloned strain: DH5 alpha
    Culture conditions: 37 centigrade, aerobic LB
    Expression host: yeast cells
    5'sequencing primers: AOX5:GACTGGTTCCAATTGACAAGC
    3'sequencing primers: AOX3:GGCAAATGGCATTCTGACAT
    Use: Yeast expression


    pPIC9k Description

    Kana resistance gene exists in the pPIC9K vector, which allows the use of kana resistance to screen polyclonal copies in yeast. The size of the 1. carrier is 9276 BP. In the 2. vector construction process, the single restriction endonuclease loci available for SnaB I, EcoR I, Avr II, Not I. 3. use alpha factor to secrete signal peptide and secrete the expressed protein gene. 4. during the construction of the carrier, your gene must be guaranteed to be in accordance with the reading frame of the starting codon of the signal peptide. 5. Pichia pastoris was screened by HIS4. 6. in order to insert genes GS115 or KM71 AOX, using the SacI restriction endonuclease linearized plasmids (His+Mut+ genotype, GS115 KM71 His+ MutS 7.. Genotype) to insert genes GS115 or KM71 His4, using Sal I or Stu I restriction endonuclease of the linearized plasmid (His+ the genotype of Mut+, GS115 in KM71 His+ MutS genotype) 8. of the AOX1 gene into the GS115 region, need to use the Bgl II linearized plasmids (His+MutS genotype).


    pPIC9k Sequence

    LOCUS       Exported                9276 bp ds-DNA     circular SYN 10-SEP-2016

    DEFINITION  synthetic circular DNA

    KEYWORDS    Untitled 2

    SOURCE      synthetic DNA construct

      ORGANISM  synthetic DNA construct

    REFERENCE   1  (bases 1 to 9276)

      AUTHORS   .

      TITLE     Direct Submission

    FEATURES             Location/Qualifiers

         source          1..9276

                         /organism="synthetic DNA construct"

                         /mol_type="other DNA"

         promoter        2..937

                         /gene="Pichia pastoris AOX1"

                         /note="AOX1 promoter"

                         /note="inducible promoter, regulated by methanol"

         CDS             949..1215



                         /product="N-terminal secretion signal from S. cerevisiae 


                         /note="alpha-factor secretion signal"

                         /note="Cleavage by the Kex2 protease occurs after the 

                         dibasic KR sequence. The EA dipeptides are then removed by 

                         dipeptidyl aminopeptidase A."



         terminator      1321..1567

                         /gene="Pichia pastoris AOX1"

                         /note="AOX1 terminator"

                         /note="transcription terminator for AOX1"

         CDS             complement(1980..4514)


                         /gene="Pichia pastoris HIS4"

                         /product="multifunctional enzyme, required for histidine 



                         /note="auxotrophic marker for Pichia pastoris"
















         CDS             complement(4928..5743)



                         /product="aminoglycoside phosphotransferase"


                         /note="confers resistance to kanamycin in bacteria or G418 

                         (Geneticin(R)) in eukaryotes"






         misc_feature    6122..6878

                         /note="AOX1 3' fragment"

                         /note="region downstream of Pichia pastoris AOX1 gene"

         misc_feature    7021..7161


                         /note="basis of mobility region from pBR322"

         rep_origin      complement(7347..7935)



                         /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 


         CDS             complement(8106..8966)





                         /note="confers resistance to ampicillin, carbenicillin, and

                         related antibiotics"







         promoter        complement(8967..9071)


                         /note="AmpR promoter"


            1 agatctaaca tccaaagacg aaaggttgaa tgaaaccttt ttgccatccg acatccacag

           61 gtccattctc acacataagt gccaaacgca acaggagggg atacactagc agcagaccgt

          121 tgcaaacgca ggacctccac tcctcttctc ctcaacaccc acttttgcca tcgaaaaacc

          181 agcccagtta ttgggcttga ttggagctcg ctcattccaa ttccttctat taggctacta

          241 acaccatgac tttattagcc tgtctatcct ggcccccctg gcgaggttca tgtttgttta

          301 tttccgaatg caacaagctc cgcattacac ccgaacatca ctccagatga gggctttctg

          361 agtgtggggt caaatagttt catgttcccc aaatggccca aaactgacag tttaaacgct

          421 gtcttggaac ctaatatgac aaaagcgtga tctcatccaa gatgaactaa gtttggttcg

          481 ttgaaatgct aacggccagt tggtcaaaaa gaaacttcca aaagtcgcca taccgtttgt

          541 cttgtttggt attgattgac gaatgctcaa aaataatctc attaatgctt agcgcagtct

          601 ctctatcgct tctgaacccc ggtgcacctg tgccgaaacg caaatgggga aacacccgct

          661 ttttggatga ttatgcattg tctccacatt gtatgcttcc aagattctgg tgggaatact

          721 gctgatagcc taacgttcat gatcaaaatt taactgttct aacccctact tgacagcaat

          781 atataaacag aaggaagctg ccctgtctta aacctttttt tttatcatca ttattagctt

          841 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga

          901 caacttgaga agatcaaaaa acaactaatt attcgaagga tccaaacgat gagatttcct

          961 tcaattttta ctgcagtttt attcgcagca tcctccgcat tagctgctcc agtcaacact

         1021 acaacagaag atgaaacggc acaaattccg gctgaagctg tcatcggtta ctcagattta

         1081 gaaggggatt tcgatgttgc tgttttgcca ttttccaaca gcacaaataa cgggttattg

         1141 tttataaata ctactattgc cagcattgct gctaaagaag aaggggtatc tctcgagaaa

         1201 agagaggctg aagcttacgt agaattccct agggcggccg cgaattaatt cgccttagac

         1261 atgactgttc ctcagttcaa gttgggcact tacgagaaga ccggtcttgc tagattctaa

         1321 tcaagaggat gtcagaatgc catttgcctg agagatgcag gcttcatttt tgatactttt

         1381 ttatttgtaa cctatatagt ataggatttt ttttgtcatt ttgtttcttc tcgtacgagc

         1441 ttgctcctga tcagcctatc tcgcagctga tgaatatctt gtggtagggg tttgggaaaa

         1501 tcattcgagt ttgatgtttt tcttggtatt tcccactcct cttcagagta cagaagatta

         1561 agtgagaagt tcgtttgtgc aagcttatcg ataagcttta atgcggtagt ttatcacagt

         1621 taaattgcta acgcagtcag gcaccgtgta tgaaatctaa caatgcgctc atcgtcatcc

         1681 tcggcaccgt caccctggat gctgtaggca taggcttggt tatgccggta ctgccgggcc

         1741 tcttgcggga tatcgtccat tccgacagca tcgccagtca ctatggcgtg ctgctagcgc

         1801 tatatgcgtt gatgcaattt ctatgcgcac ccgttctcgg agcactgtcc gaccgctttg

         1861 gccgccgccc agtcctgctc gcttcgctac ttggagccac tatcgactac gcgatcatgg

         1921 cgaccacacc cgtcctgtgg atctatcgaa tctaaatgta agttaaaatc tctaaataat

         1981 taaataagtc ccagtttctc catacgaacc ttaacagcat tgcggtgagc atctagacct

         2041 tcaacagcag ccagatccat cactgcttgg ccaatatgtt tcagtccctc aggagttacg

         2101 tcttgtgaag tgatgaactt ctggaaggtt gcagtgttaa ctccgctgta ttgacgggca

         2161 tatccgtacg ttggcaaagt gtggttggta ccggaggagt aatctccaca actctctgga

         2221 gagtaggcac caacaaacac agatccagcg tgttgtactt gatcaacata agaagaagca

         2281 ttctcgattt gcaggatcaa gtgttcagga gcgtactgat tggacatttc caaagcctgc

         2341 tcgtaggttg caaccgatag ggttgtagag tgtgcaatac acttgcgtac aatttcaacc

         2401 cttggcaact gcacagcttg gttgtgaaca gcatcttcaa ttctggcaag ctccttgtct

         2461 gtcatatcga cagccaacag aatcacctgg gaatcaatac catgttcagc ttgagacaga

         2521 aggtctgagg caacgaaatc tggatcagcg tatttatcag caataactag aacttcagaa

         2581 ggcccagcag gcatgtcaat actacacagg gctgatgtgt cattttgaac catcatcttg

         2641 gcagcagtaa cgaactggtt tcctggacca aatattttgt cacacttagg aacagtttct

         2701 gttccgtaag ccatagcagc tactgcctgg gcgcctcctg ctagcacgat acacttagca

         2761 ccaaccttgt gggcaacgta gatgacttct ggggtaaggg taccatcctt cttaggtgga

         2821 gatgcaaaaa caatttcttt gcaaccagca actttggcag gaacacccag catcagggaa

         2881 gtggaaggca gaattgcggt tccaccagga atatagaggc caactttctc aataggtctt

         2941 gcaaaacgag agcagactac accagggcaa gtctcaactt gcaacgtctc cgttagttga

         3001 gcttcatgga atttcctgac gttatctata gagagatcaa tggctctctt aacgttatct

         3061 ggcaattgca taagttcctc tgggaaagga gcttctaaca caggtgtctt caaagcgact

         3121 ccatcaaact tggcagttag ttctaaaagg gctttgtcac cattttgacg aacattgtcg

         3181 acaattggtt tgactaattc cataatctgt tccgttttct ggataggacg acgaagggca

         3241 tcttcaattt cttgtgagga ggccttagaa acgtcaattt tgcacaattc aatacgacct

         3301 tcagaaggga cttctttagg tttggattct tctttaggtt gttccttggt gtatcctggc

         3361 ttggcatctc ctttccttct agtgaccttt agggacttca tatccaggtt tctctccacc

         3421 tcgtccaacg tcacaccgta cttggcacat ctaactaatg caaaataaaa taagtcagca

         3481 cattcccagg ctatatcttc cttggattta gcttctgcaa gttcatcagc ttcctcccta

         3541 attttagcgt tcaacaaaac ttcgtcgtca aataaccgtt tggtataaga accttctgga

         3601 gcattgctct tacgatccca caaggtggct tccatggctc taagaccctt tgattggcca

         3661 aaacaggaag tgcgttccaa gtgacagaaa ccaacacctg tttgttcaac cacaaatttc

         3721 aagcagtctc catcacaatc caattcgata cccagcaact tttgagttgc tccagatgta

         3781 gcacctttat accacaaacc gtgacgacga gattggtaga ctccagtttg tgtccttata

         3841 gcctccggaa tagacttttt ggacgagtac accaggccca acgagtaatt agaagagtca

         3901 gccaccaaag tagtgaatag accatcgggg cggtcagtag tcaaagacgc caacaaaatt

         3961 tcactgacag ggaacttttt gacatcttca gaaagttcgt attcagtagt caattgccga

         4021 gcatcaataa tggggattat accagaagca acagtggaag tcacatctac caactttgcg

         4081 gtctcagaaa aagcataaac agttctacta ccgccattag tgaaactttt caaatcgccc

         4141 agtggagaag aaaaaggcac agcgatacta gcattagcgg gcaaggatgc aactttatca

         4201 accagggtcc tatagataac cctagcgcct gggatcatcc tttggacaac tctttctgcc

         4261 aaatctaggt ccaaaatcac ttcattgata ccattattgt acaacttgag caagttgtcg

         4321 atcagctcct caaattggtc ctctgtaacg gatgactcaa cttgcacatt aacttgaagc

         4381 tcagtcgatt gagtgaactt gatcaggttg tgcagctggt cagcagcata gggaaacacg

         4441 gcttttccta ccaaactcaa ggaattatca aactctgcaa cacttgcgta tgcaggtagc

         4501 aagggaaatg tcatacttga agtcggacag tgagtgtagt cttgagaaat tctgaagccg

         4561 tatttttatt atcagtgagt cagtcatcag gagatcctct acgccggacg catcgtggcc

         4621 gacctgcagg gggggggggg gcgctgaggt ctgcctcgtg aagaaggtgt tgctgactca

         4681 taccaggcct gaatcgcccc atcatccagc cagaaagtga gggagccacg gttgatgaga

         4741 gctttgttgt aggtggacca gttggtgatt ttgaactttt gctttgccac ggaacggtct

         4801 gcgttgtcgg gaagatgcgt gatctgatcc ttcaactcag caaaagttcg atttattcaa

         4861 caaagccgcc gtcccgtcaa gtcagcgtaa tgctctgcca gtgttacaac caattaacca

         4921 attctgatta gaaaaactca tcgagcatca aatgaaactg caatttattc atatcaggat

         4981 tatcaatacc atatttttga aaaagccgtt tctgtaatga aggagaaaac tcaccgaggc

         5041 agttccatag gatggcaaga tcctggtatc ggtctgcgat tccgactcgt ccaacatcaa

         5101 tacaacctat taatttcccc tcgtcaaaaa taaggttatc aagtgagaaa tcaccatgag

         5161 tgacgactga atccggtgag aatggcaaaa gcttatgcat ttctttccag acttgttcaa

         5221 caggccagcc attacgctcg tcatcaaaat cactcgcatc aaccaaaccg ttattcattc

         5281 gtgattgcgc ctgagcgaga cgaaatacgc gatcgctgtt aaaaggacaa ttacaaacag

         5341 gaatcgaatg caaccggcgc aggaacactg ccagcgcatc aacaatattt tcacctgaat

         5401 caggatattc ttctaatacc tggaatgctg ttttcccggg gatcgcagtg gtgagtaacc

         5461 atgcatcatc aggagtacgg ataaaatgct tgatggtcgg aagaggcata aattccgtca

         5521 gccagtttag tctgaccatc tcatctgtaa catcattggc aacgctacct ttgccatgtt

         5581 tcagaaacaa ctctggcgca tcgggcttcc catacaatcg atagattgtc gcacctgatt

         5641 gcccgacatt atcgcgagcc catttatacc catataaatc agcatccatg ttggaattta

         5701 atcgcggcct cgagcaagac gtttcccgtt gaatatggct cataacaccc cttgtattac

         5761 tgtttatgta agcagacagt tttattgttc atgatgatat atttttatct tgtgcaatgt

         5821 aacatcagag attttgagac acaacgtggc tttccccccc ccccctgcag gtcggcatca

         5881 ccggcgccac aggtgcggtt gctggcgcct atatcgccga catcaccgat ggggaagatc

         5941 gggctcgcca cttcgggctc atgagcgctt gtttcggcgt gggtatggtg gcaggccccg

         6001 tggccggggg actgttgggc gccatctcct tgcatgcacc attccttgcg gcggcggtgc

         6061 tcaacggcct caacctacta ctgggctgct tcctaatgca ggagtcgcat aagggagagc

         6121 gtcgagtatc tatgattgga agtatgggaa tggtgatacc cgcattcttc agtgtcttga

         6181 ggtctcctat cagattatgc ccaactaaag caaccggagg aggagatttc atggtaaatt

         6241 tctctgactt ttggtcatca gtagactcga actgtgagac tatctcggtt atgacagcag

         6301 aaatgtcctt cttggagaca gtaaatgaag tcccaccaat aaagaaatcc ttgttatcag

         6361 gaacaaactt cttgtttcga actttttcgg tgccttgaac tataaaatgt agagtggata

         6421 tgtcgggtag gaatggagcg ggcaaatgct taccttctgg accttcaaga ggtatgtagg

         6481 gtttgtagat actgatgcca acttcagtga caacgttgct atttcgttca aaccattccg

         6541 aatccagaga aatcaaagtt gtttgtctac tattgatcca agccagtgcg gtcttgaaac

         6601 tgacaatagt gtgctcgtgt tttgaggtca tctttgtatg aataaatcta gtctttgatc

         6661 taaataatct tgacgagcca aggcgataaa tacccaaatc taaaactctt ttaaaacgtt

         6721 aaaaggacaa gtatgtctgc ctgtattaaa ccccaaatca gctcgtagtc tgatcctcat

         6781 caacttgagg ggcactatct tgttttagag aaatttgcgg agatgcgata tcgagaaaaa

         6841 ggtacgctga ttttaaacgt gaaatttatc tcaagatctc tgcctcgcgc gtttcggtga

         6901 tgacggtgaa aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc

         6961 ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg

         7021 cgcagccatg acccagtcac gtagcgatag cggagtgtat actggcttaa ctatgcggca

         7081 tcagagcaga ttgtactgag agtgcaccat atgcggtgtg aaataccgca cagatgcgta

         7141 aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc gctgcgctcg

         7201 gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg gttatccaca

         7261 gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa ggccaggaac

         7321 cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac

         7381 aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg

         7441 tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac

         7501 ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat

         7561 ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag

         7621 cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac

         7681 ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt

         7741 gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt

         7801 atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc

         7861 aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga

         7921 aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac

         7981 gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt cacctagatc

         8041 cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta aacttggtct

         8101 gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct atttcgttca

         8161 tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg cttaccatct

         8221 ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga tttatcagca

         8281 ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt atccgcctcc

         8341 atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt taatagtttg

         8401 cgcaacgttg ttgccattgc tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct

         8461 tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa

         8521 aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta

         8581 tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc

         8641 ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg

         8701 agttgctctt gcccggcgtc aacacgggat aataccgcgc cacatagcag aactttaaaa

         8761 gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg

         8821 agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc

         8881 accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg

         8941 gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat

         9001 cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata

         9061 ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc

         9121 atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtcttca agaattaatt

         9181 ctcatgtttg acagcttatc atcgataagc tgactcatgt tggtattgtg aaatagacgc

         9241 agatcgggaa cactgaaaaa taacagttat tattcg


    1.  This product is FOR RESEARCH USE ONLY!
    2.  The item is lyophilized form, Please take the powder plasmid by centrifugation at 5000rpm/min for 1min. Add 20μl ddH2O in to the tube of plasmid.